Human TAFA2/FAM19A2 Protein, hFc TagProduct Propertie Alternative Names TAFA2, FAM19A2, TAFA 2 Species Human Expression Sequence Ala31 His131 Accession Q8N3H0 1 Tag N hFc Expression System HEK293 Molecular Weight The protein has a predicted MW of 36. 74 kDa. Due to glycosylation, the protein migrates to 40 50 kDa based on SDS PAGE result. Purity > 95% as determined by SDS PAGE and HPLC. Endotoxin < 1. 0 EU per g by the LAL method. Formulation Lyophilized from 0. 22 m filtered solution

41328_Manual_Ver

Fibroblast growth factor-21 (FGF-21) belongs to the large FGF family which is encoded by the FGF-21 gene

A-B: Clony plate

List of cell lines successfully transfected with Hieff Trans™ Liposomal Transfection Reagent (Under continuous update)

Dose response curve for Human IL-22R alpha 1&IL-10R beta

and the detection rates of reagents of various brands were compared

7μg/ml determined by ELISA

50% glycerin Unit Definition 1 unit: The amount of enzyme required to incorporate 10 pmol GTP (α- 32P) into a transcript with 80 nucleotides (80 nt) at 37℃ within 1 hour

Proven effective at removing high concentrations of dried-on RNase A

ATAGTCGTGTGTTAACGGGTAATATGCG↑CGCATATTACCTGATAACACACGACTAT

IL-18 promotes the production of Th2 cytokines IL-4 and IL-13 by CD4+ T cells and basophils

12606_MSDS_HB250714_EN